E se te dissessem que as mulheres são listradas? Que elas têm um padrão mágico secreto tatuado pela Vida em suas peles como se fossem uma zebra ou tigresa? Pois de acordo com a ciência, elas tem sim.

Já tratamos sobre Epigenética em outro post, então, resumidamente, é a ciência que estuda como o organismo liga e desliga nossos genes. A escrita do DNA é estável (mutações são coisas raras e imprevisíveis), mas a maneira de ler este código pode variar muito de acordo com as necessidades do indivíduo. Afinal, todas as nossas células possuem as mesmas informações genéticas, mas cada tipo de célula precisa de proteínas diferentes para funcionar. Elas necessitam “silenciar” todos os outros genes dos quais não precisam. Por exemplo, uma célula do pancreas precisa da informação de como fabricar insulina, mas a receita da síntese de oxitocina é inútil para ela. E como as células “dizem” quais genes devem ser ignorados pelo RNA (o “leitor/tradutor” do DNA na configuração de proteínas)? Um dos métodos se chama metilação. Mas primeiro vamos relembrar as aulas de Ciências.

Dentro do núcleo das células, bem emaranhado e se contorcendo como um miojo na água fervente, está o seu código DNA: um “texto” de apenas 4 letras – A (adenina), G (guanina), C (citosina) e T (tiamina) – as chamadas bases, moléculas com geometrias específicas que se encaixam como os dentes de um zíper no modelo de dupla hélice.

 

Átomos de oxigênio, hidrogênio, nitrogênio e carbono formam as moléculas base (A,G,T,C) do DNA. Imagem: mashable.com/2013/06/13/

Átomos de oxigênio, hidrogênio, nitrogênio e carbono formam as moléculas base (A,G,T,C) do DNA. Imagem: mashable.com/2013/06/13/

 

A sequência mais parece uma sopa de letrinhas aleatória (AGATCCTAGCCGATATGACGAT…) e os genes nada mais são do que trechos, alguns mais longos que outros, dessa sequência que, para as células, significam coisas como “você vai produzir pigmento castanho”. A sequência inteira é dividida em 46 pedaços chamados cromossomos. Cada cromossomo tem vários genes.

Sua sequência de DNA, exclusiva para cada indivíduo, se formou quando 23 cromossomos da sua mãe se uniram a 23 cromossomos do seu pai. 22 desses cromossomos de cada progenitor formam pares perfeitos, mas o 23º par é o que define o sexo, onde:

 

2 cromossomos X originam fêmeas
1 cromossomo X e 1 Y originam machos

Como os cromossomos do par 23 de machos são diferentes (XY), ambos podem permanecer ativos sem problemas.

Já no par 23 das fêmeas, os cromossomos são exatamente iguais (XX) e, se um deles não for “desligado”, o código será lido duplamente e isso acarretará problemas. Um deles precisa ser silenciado.

Acontece quando o embrião fêmea (composto então por 100 células) tem apenas 4 dias. Nesta fase, tanto o cromossomo X da mãe quanto o cromossomo X do pai estão ativos. Depois de uma batalha molecular, um dos X vence e o outro é desativado.

Isso é feito embrulhando o DNA bem apertado e modificando as extensões sinuosas das histonas (proteínas em volta das quais o DNA está emaranhado). Novas proteínas adicionais também são acrescentadas para grudar tudo e finalmente as metilas (marcadores moleculares) são adicionadas ao DNA para sinalizar à célula que “esta parte não deve ser lida”: é a metilação.

Tudo isso junto torna este pedaço de DNA de acesso muito restrito ao mecanismo molecular que colhe as informações do código. Ele foi enrolado, amassado, amarrado, grudado e… silenciado. Enquanto isso o cromossomo X ativo está mais livre e desenrolado, mais acessível para o RNA ler e dar início à síntese de proteínas necessárias aquele tipo de célula em específico.

O interessante sobre a inativação do cromossomo X é que parece meio aleatório qual dos dois X vence em cada célula. Em algumas é o X do pai, em outras é o X da mãe.

celulas-01

 

Então esse embrião fêmea de 100 células tem uma mistura de cromossomos ativos. Mas desse ponto em diante, a medida em que estas células vão se dividindo, elas mantém o cromossomo X vencedor da célula que lhe deu origem. E isso continua até a idade adulta.

Então se você pudesse olhar para a pele de uma mulher e ver onde estão cada um desses dois grupos de células, você veria um padrão listrado que mostra o crescimento e migração das células originadas dessas 100 primeiras de quando o embrião tinha 4 dias (não confundir com as Linhas de Blaschko ).

 

Somos todas listradas

Somos todas listradas

Veja o vídeo completo acerca do fenômeno por Veritasium, com Derek Muller, (em inglês) aqui.

Porque as células se espalham formando esse desenho? Será que as forças de tensão entre a profusão de células do embrião obedecem sempre a um padrão específico? O que leva células cuja única diferença é a origem do cromossomo X ativo em seus núcleos a se agruparem de forma tão equilibrada? É mistério. É magia. É ciência.

Em algum ponto da evolução animal, uma mutação associou o gene da pigmentação ao cromossomo X de algumas espécies, como as fêmeas de gatos Calico. O que nos leva a perguntar se nossa pigmentação já esteve ligada ao cromossomo X. Em outras palavras, será que humanos primitivos já possuíram listras visíveis?

 

Lêmures - primatas listrados. Imagem: www.animalfactguide.com

Lêmures – primatas listrados. Imagem: www.animalfactguide.com

 

Não consegue imaginar humanos listrados? Bom, também foi difícil para os fãs de Jurassic Park assimilarem que os dinossauros tinham penas coloridas e no entanto

 

“Parrotceratops”. Tá difícil de engolir esse? Imagem: http://dinosaurs.wikia.com/

“Parrotceratops”. Tá difícil de engolir esse? Imagem: http://dinosaurs.wikia.com/

Reconstrução artística de ninho de oviraptor Citipati. Melhorou? Imagem: http://portfolios.risd.edu/gallery/3308366/Feathered-Dinosaurs

Reconstrução artística de ninho de oviraptor Citipati. Melhorou? Imagem: http://portfolios.risd.edu/gallery/3308366/Feathered-Dinosaurs

E agora? Casuarius casuarius no Zoológico de Beijing. Foto de Rachel-sr no Devianart

E agora? Casuarius casuarius no Zoológico de Beijing. Foto de Rachel-sr no Devianart

E esses são os ovinhos da criança. Tinha que ser da Austrália… Foto por Christian Ziegler para nationalgeographic.com

E esses são os ovinhos da criança. Tinha que ser da Austrália… Foto por Christian Ziegler para nationalgeographic.com

 

Agora pense, se o esqueleto desta ave que não voa fosse descoberto fossilizado milhões de anos depois, seria óbvia a suposição de que possuia penas? Do mesmo modo, os fósseis de hominídeos não nos permitem praticamente nenhuma pista sobre padrões de pigmentação da pele de nossas raças ancestrais. É no mínimo divertido pensar na hipótese da incrível tribo dos pigmeus listrados dando origem a criaturas mitológicas, como as fadas.

Se tem uma coisa que o percurso da ciência nos ensinou é que devemos verificar indícios, sim, mas sempre com a mente aberta. Se humanos já perderam rabo e pelos, por que não listras?

Ou será que as listras das mulheres são tão visíveis quanto as dos tigres, mas numa cor que ainda não evoluímos o suficiente para perceber? É mistério. É magia. É ciência.

 

 

 

Share: